Strong T7 promoters are lethal to E. coli cells in the presence of large amounts of T7 RNA polymerase. The combination of SP6 promoter-SP6 RNA polymerase is also stressful to E. coli cells. The instability of strong promoter-RNA polymerase combination is said to be the effect of a NTP sink. However it can be also explained by plasmid loss due to inhibition of plasmid replication. Promoters oriented in the opposite direction of replication origin of ColEl-type plasmid, reduce the copy numbers of the plasmid in the presence of appropriate RNA polymerase. However a transcription termination signal relieves the copy number reduction, probably, by inhibiting the production of long RNA transcripts containing RNA I sequence at the 3' end. Copy number of pGEM4Z which containing a SP6 promoter against ori was reduced to 80, and pGEM4ZS with a terminator down-stream the SP6 promoter was reduced to 290 in E. coli JM109 (pACSP6R) from 400.
SP6 promoter has consensus sequence of ATTTAGGTGACACTATAGAAGA from -17 to +5. It is suggested that the region from -17 to -4 is binding domain and -3 to +5 is initiation domain. The importance of several positions was determined by cloning of randomly mutated SP6 promoter. The single point mutations, a G to A substitution at -11 and a T to C at -2 significantly reduced the the promoter activity to 15%. The single substitution of a T to G at -14 and -4, and a G to T at +1 also lead to the reduction of promoter activity to 21-22%. The single base substitutions of a A to T at -8, a C to T at -7, a T to A at -2 and a C to A at -5 retained about half of the promoter activity. The hierarchy of importance was partially determined as -11, -2 ＞ -14, -4, +1 ＞ -8, -7, -5, -9 ＞ -12, -10.
강한 T7 전사촉진제들은 많은 양의 T7 RNA 중합효소가 존재할 경우 E. coli 세포들에게 치명적이다. SP6 전사촉진제와 SP6 RNA 중합효소의 조합도 E. coli 세포에 강한 스트레스를 준다. 강한 전사촉진제와 RNA 중합효소의 조합이 일으키는 세포의 불안정성은 NTP sink 효과때문으로 생각되어져 왔다. 그러나 이 불안정성은 강한 전사촉진제가 플라스미드의 복제를 억제함으로써 나타나는 플라스미드의 손실에 기인할 수도 있다. ColE1형 플라스미드의 복제 origin과 반대 방향으로 위치하는 전사촉진제들은 이 전사촉진제들을 인식하는 RNA 중합효소가 존재할 경우 플라스미드의 copy 수를 감소시킨다. 하지만 이러한 전사촉진제의 downstream에 전사종결제가 존재하면 copy 수가 어느정도 다시 회복되는 데 이는 아마도 3' 끝에 RNA I 염기서열을 가지고 있는 긴 RNA 전사체의 합성을 억제하기 때문인듯 하다. SP6 전사촉진제를 가지고 있는 pGEM4Z는 SP6 RNA 중합효소가 존재하는 경우 copy 수가 400에서 80으로 줄었고, SP6 전사촉진제의 downstream에 전사종결제를 가지는 pGEM4ZS의 copy수는 400에서 290으로 줄었다.
SP6 전사촉진제는 -17부터 +5까지 ATTTAGGTGACACTATAGAAGA의 consensus 염기서열을 가지고 있다. 이 촉진제의 -17부터 -4까지는 RNA 중합효소의 결합 도메인이며, -3부터 +5까지는 시작 도메인으로 제안되어져왔다. 이 연구에서는 무작위로 돌연변이를 일으킨 SP6 전사촉진제를 클로닝하여 여러 위치의 염기들의 전사촉진제 기능에 대한 중요성을 결정하였다. -11에서의 G에서 A로의 변화와 -2에서의 T에서 C로의 변화와 같은 한점 돌연변이들은 전사활성도를 85%정도 감소시켰다. 그리고 -4와 -14에서의 G에서 T로의 변화, +1에서의 G에서 T로의 변화도 전사활성도를 약 80% 감소시켰다. 그외에 -8에서의 A에서 T, -7에서의 C에서 T, -2에서의 T에서 A, -5에서의 C에서 A로의 변화는 34-48%의 전사활성도를 유지하였다. 각 염기의 전사활성도에 대한 중요도는 -11, -2 ＞ -14, -4, +1 ＞ -8, -7, -5, -9 ＞ -12, -10로 결정되었다.
