The nucleotide sequence of the full length canine gastrin gene and its flanking regions were determined. The 2.3-kb gene consists of three exons and two introns. The 300 bp upstream flanking region sequence reveals some transcription regulatory sequences. Also the 450 bp downstream sequence reveals a putative transcription terminator sequence. The 1.7 kb intron I, about half the size of human intron I, is located in the 5' untranslated region and the 117 bp intron II interrupts the aspartic acid codon at position 71 of preprogastrin. All the intron-exon junctions contain the consensus sequences of the 5' and 3' ends of eucaryotic introns, 5' GT and AG 3', respectively. A putative transcription initiation site is assigned to the adenine at 64 bp upsteam from the first exon-intron junction on the basis of sequence comparsion of human and canine gastrin promoters. A possible 'TATA' equivalent sequence TTATAA is located at 28 bp upstream from the putative cap site. However, 'CAAT' box equivalent sequence is not found in either orientation. A ploy(A) addition signal, AAUAAA, is located at 62 base pairs downstream from the termination codon UAG. The 5' regulatory sequence also contains Ap-1 and Ap-2 binding sites, which suggests transcription regulation by these transcription factors. A putative terminator, TTTTTAATATTTTACTTATTTATTTATTT, which resembles the human terminator sequence TTTTTTTTTAATTTTTATTTTATTTTATTTTT is located at approximately 160 bp downstream of the ploy(A) addition site. It has a 6.5 bp inverted repeat sequence unlike the 10.5 bp inverted repeat symmetry of human gastrin terminator.
개의 위액분비촉진 홀몬 gastrin 의 발현에 대한 이해와 정보를 얻기위해 개의 gasrin 유전자를 분리하여 그 염기서열을 밝혔다. gastrin 유전자는 한 개로 추정되며, 그 크기는 약 2,300 염기쌍이다. 인간과 마찬가지로, 개의 gastrin 유전자도 세 개의 intron 과 두 개의 exon 으로 분리되어 있으며, intron I 은 5' 의 translation 이 되지않는 부위에 있으며, 그 크기가 3,300 염기쌍인 인간의 것의 절반에 해당하는 1,700 염기쌍 이다. 117 개의 염기쌍으로 이루어진 intron II 는 preprogastrin 의 71번째 아미노산인 Aspartic acid 의 codon 내에 있다. 인간의 gastrin 유전자와 promoter 염기 서열을 비교 분석한 결과, exon I 과 intron I 의 연결부위로부터 64 개의 염기쌍 위에 있는 'A' 염기가 전사 시작점으로 생각된다. TATA box 로 추정되는 TATAA가 가상적인 전사 시작 염기로 부터 28 염기쌍 위에서 발견되었으나, CAAT box 에 해당하는 염기 서열은 보이지 않았다. poly(A) 첨가표 시인 AAUAAA 염기서열이 세 번째 exon 의 termination codon (UAG) 에서 62 염기쌍 아래에 존재한다. 모든 intron-exon 연결부위들은 AG/GU 법칙을 준수하고 있다. 개의 gastrin 유전자는 transcription factor Ap-1 과 Ap-2 의 인지 염기 서열들을 가지고 있다. 이것은 이들 염기서열들에 결합하는 transcription factors 을 통해 gastrin 유전자의 전사가 조절된다는 것을 시사한다. 최초로 인간의 가스트린 유전자에서 RNA polymerase II 의 전사종결자로 확인된 염기서열 TTTTTTTTTAATTTTTATTTT ATTTTATTTTT 과 유사한 염기서열인 TTTTTAATATTTTACTTATTTATTTATTT 가 마지막 exon으로 부터 약 160 염기쌍 아래에서 발견되었다. 이 염기서열은 인간의 10.5 bp inverted repeat 구조와는 다르게 6.5 bp inverted repeat 구조를 이루고 있다.