Solution structure of catalytic DNA PS5.M(d(GTGGGTCATTGTGGGTGGGTGTGG)) was studied by NMR and CD spectroscopy. PS5.M obtained by in vitro selection to NMM(N-methyl mesoprophyrin) has been reported to catalyze the metallation f mesoporphyrinIX(MPIX) by copper and zinc ions. The requirements for potassium ion for activity and the heavily guanine-rich sequence of the DNAzyme has cumulatively suggested that the folded and active form of PS5.M might contain quanine quartets.
PS5.M at room temperature adopt mainly parallel quartet structure as judged by a characteristic CD signature. Temperature dependent CD spectra show remarkable conformational shift at high temperature(50℃). The previous result of activity test that catalytic activity is maximum at 40-50℃ suggests that conformation of PS5.M at high temperature(50℃) may be catalytically active structure. NMR spectra acquired in various salt conditions show only one broad imino peak although some splittings were observed in high temperature(50℃). The absence of splittings in $Li^+$ salt, which is known to be inactive in guanine quartet formation, and the comparison with the conventional G-quartet inmino spectra suggest that PS5.M should be a G-quartet related structure in high temperature. Based on the above evidence compact dimeric antiparallel guanine-quartet model is suggested as the major structure of catalytically active PS5.M.
